manP [2019-09-06 10:35:21]

mannose-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIBCA of the [category|SW 1.2.2|PTS], [category|SW 3.4.3|Trigger enzyme], control of [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR] activity

locus: BSU_12010

pI: 6.72

mw: 61.81 kDa

protein length: 650 aa

gene length: 1953 bp

function: mannose uptake and phosphorylation, control of [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR] activity

product: mannose-specific [category|SW 1.2.2|PTS], EIIBCA

essential: no

synonyms: yjdD

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
• [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.9|Utilization of mannose]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.4|Control of PRD-type regulators]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.1|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]

Gene

Coordinates: 1,272,725 1,274,677

The protein

Catalyzed reaction/ biological activity

• transport and concomitant phosphorylation of mannose
• D-mannose + N^π-phospho-L-histidyl-[protein] --> D-mannose 6-phosphate + L-histidyl-[protein] (according to UniProt)

Protein family

• [category|SW 1.2.2|PTS] permease, fructose/ mannitol family [Pubmed|10627040]

Paralogous protein(s)

• [protein|973C3D3FBFDCA095A760C5F49A96D8BE48771014|FruA]

[SW|Domains]

• [SW|PTS EIIC domain] type-2 (aa 123-456) (according to UniProt)

Modification

• phosphorylation on Ser-365 [Pubmed|17218307]

Structure

• [PDB|2R48] (IIA domain)
• [PDB|2R4Q] ([protein|973C3D3FBFDCA095A760C5F49A96D8BE48771014|FruA], IIB domain, 56% identity)

[SW|Localization]

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• genes: [gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF]
  description: [Pubmed|20139185]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20139185], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  regulatory mechanism

  • [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR]: activation, in the presence of mannose and absence of glucose [Pubmed|20139185], in [regulon|F273002AF97D87BB025B4F014C328C5592EAD621|ManR regulon]
  • [regulon|RNA switch|RNA switch]: termination/antitermination, expession may be controlled by a potential [SW|RNA switch] located in the 5' untranslated region of the [gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF] mRNA between [gene|E26C70893C5D677C816C814558CC42F90B920087|manA] and [gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF], in [regulon|RNA switch|RNA switch]

  regulation

  • induced by mannose ([protein|search|ManR]) [Pubmed|20139185]

Biological materials

Mutant

• MGNA-A270 (yjdD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/270 NBRP B. subtilis, Japan]
• BKE12010 ([gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGAAACCTCCTTTAAA, downstream forward: _UP4_ATCGAATAAAGCGGGGGATT
• BKK12010 ([gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGAAACCTCCTTTAAA, downstream forward: _UP4_ATCGAATAAAGCGGGGGATT

References

• 10627040,17218307,10627040,20139185,23033921,23551403,26238998